View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0884_low_8 (Length: 313)
Name: NF0884_low_8
Description: NF0884
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0884_low_8 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 139; Significance: 1e-72; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 139; E-Value: 1e-72
Query Start/End: Original strand, 1 - 224
Target Start/End: Original strand, 47581548 - 47581770
Alignment:
| Q |
1 |
agaagattacaatttaatttaattttttattttnnnnnnngcatgtaaaatttaatgtttcctagttgtgtgtgtagaattggtgaactttccaattaac |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
47581548 |
agaagattacaatttaatttaattttttattttaaaaaaagcatgtaaaattaaatgtttcctagttgtctgtgtagaattggtgaactttccaattaac |
47581647 |
T |
|
| Q |
101 |
taatgtactagtnnnnnnnnnctgattcattcaatcaaatggtgaaagaaagaagnnnnnnnngtagtattgtgttgcagagaagattcccttgttactt |
200 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47581648 |
taatgtactagt-aaaaaaaactgattcattcaatcaaatggtgaaagaaagaagaaaaaaaagtagtattgtgttgcagagaagattcccttgttactt |
47581746 |
T |
|
| Q |
201 |
ttcctttttatcattaatgatgat |
224 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
47581747 |
ttcctttttatcattaatgatgat |
47581770 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 87 times since January 2019
Visitors: 6695