View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0885_low_11 (Length: 402)
Name: NF0885_low_11
Description: NF0885
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0885_low_11 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 371; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 371; E-Value: 0
Query Start/End: Original strand, 1 - 371
Target Start/End: Complemental strand, 50337200 - 50336830
Alignment:
| Q |
1 |
tggcgtaaatcatcatggttaatgggtcgttgagaaatgacccaatcaccagaagggaatctagcaagaggctttctacctaaatccataacaacttcaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50337200 |
tggcgtaaatcatcatggttaatgggtcgttgagaaatgacccaatcaccagaagggaatctagcaagaggctttctacctaaatccataacaacttcaa |
50337101 |
T |
|
| Q |
101 |
tgagtccaccaatctcttggtgacgatacaattccatcctcatctccaaaggaagaagttccagaaacatatcaagctctgcggtggtttcgggttgcaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50337100 |
tgagtccaccaatctcttggtgacgatacaattccatcctcatctccaaaggaagaagttccagaaacatatcaagctctgcggtggtttcgggttgcaa |
50337001 |
T |
|
| Q |
201 |
attcgacggtgaggatccatttctgattgggtaacgatcggagggtcgtcggatttgaggagaagctgaagaagatgatttggaagattgaatcgcttta |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50337000 |
attcgacggtgaggatccatttctgattgggtaacgatcggagggtcgtcggatttgaggagaagctgaagaagatgatttggaagattgaatcgcttta |
50336901 |
T |
|
| Q |
301 |
ttgagtcttcttgatgaagatgatgaacgatgaaatgaagaaaacagttgtttattgttaaggttgttgtt |
371 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50336900 |
ttgagtcttcttgatgaagatgatgaacgatgaaatgaagaaaacagttgtttattgttaaggttgttgtt |
50336830 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 294 times since January 2019
Visitors: 6714