View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0885_low_17 (Length: 371)
Name: NF0885_low_17
Description: NF0885
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0885_low_17 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 175; Significance: 4e-94; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 175; E-Value: 4e-94
Query Start/End: Original strand, 159 - 333
Target Start/End: Complemental strand, 38498096 - 38497922
Alignment:
| Q |
159 |
atgattagggataaacttgagttgaaagctattaaagatggatcagtgagctatgctgcattggagaagaaggctgagttgtatgataagttagttaagg |
258 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38498096 |
atgattagggataaacttgagttgaaagctattaaagatggatcagtgagctatgctgcattggagaagaaggctgagttgtatgataagttagttaagg |
38497997 |
T |
|
| Q |
259 |
gagaattgtctgatgaagaggataaagagaagtattgtgttgattttgttcgtaagagcgatgatcatgatgatg |
333 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38497996 |
gagaattgtctgatgaagaggataaagagaagtattgtgttgattttgttcgtaagagcgatgatcatgatgatg |
38497922 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 112; E-Value: 2e-56
Query Start/End: Original strand, 10 - 125
Target Start/End: Complemental strand, 38498245 - 38498130
Alignment:
| Q |
10 |
attatactcaagagcagccaaacctgtcagaattgcttctaaagtggaaccaaacatacatttatatctttagataatacctaattgaatttctgtttgt |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
38498245 |
attatactcaagagcagccaaacctgtcagaattgcttctaaagtggaaccaaacatacatttatatctttagataatacctaattgaatttgtgtttgt |
38498146 |
T |
|
| Q |
110 |
tgataattgagattaa |
125 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
38498145 |
tgataattgagattaa |
38498130 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1163 times since January 2019
Visitors: 6711