View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0885_low_22 (Length: 337)
Name: NF0885_low_22
Description: NF0885
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0885_low_22 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 151; Significance: 7e-80; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 151; E-Value: 7e-80
Query Start/End: Original strand, 80 - 242
Target Start/End: Complemental strand, 40297693 - 40297531
Alignment:
| Q |
80 |
gttgcagagtagaatatcctaaaacccctaaaccctatccatcaagtatcaacaacaacatcaatcaacgaccgcaccgatcataccagaatttccattt |
179 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||| |||||||||||||||| |
|
|
| T |
40297693 |
gttgcagagtagaatatcctaaaacccctaaaccctatccatcaagtatcaacaacagcatcaatcaacgaccgcatcgatcaaaccagaatttccattt |
40297594 |
T |
|
| Q |
180 |
caatggcaatttcgaccttaaaattagtctgcaaacccaatcttcttcatcttcgtcctatcc |
242 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40297593 |
caatggcaatttcgaccttaaaattagtctgcaaacccaatcttcttcatcttcgtcctatcc |
40297531 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 42 times since January 2019
Visitors: 6713