View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0885_low_24 (Length: 329)
Name: NF0885_low_24
Description: NF0885
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0885_low_24 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 238; Significance: 1e-132; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 238; E-Value: 1e-132
Query Start/End: Original strand, 1 - 305
Target Start/End: Complemental strand, 7805995 - 7805672
Alignment:
Q |
1 |
agaaacatattgctacgctactagtaaaagatgatatgttctgaagacaaagatgat-------------------atgtggctgcaacttctaatgagg |
81 |
Q |
|
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||| |
|
|
T |
7805995 |
agaaacatattgctactctactagtaaaagatgatatgttctgaagacaaaggtgattcgaatacaatattctttcatgtggctgcaacttctaatgagg |
7805896 |
T |
 |
Q |
82 |
aaagtcaaccaaattcattttctagatgatgagaatggagtgatgtgtagatctgctgatgctattaacattgatcaatactactttgcagattttattc |
181 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
T |
7805895 |
aaagtcaaccaaattcattttctagatgatgagaatggagtgatgtgtagatctgctgatgctattaacattgctcaatactactttgcagattttattc |
7805796 |
T |
 |
Q |
182 |
caaaagaagcgaagcatagctcgcatgatttggtcgtaaatgcaatgccaccttctataacaaatgatgacaatgaagttttgactgctcgtattcgttt |
281 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
T |
7805795 |
caaaagaagcgaagcatagctcgcatgatttggtcgtaaatgcaatgccaccttctataacaaattatgacaatgaagttttgactgctcgtattcgttt |
7805696 |
T |
 |
Q |
282 |
tgatgaattctatagagattgatg |
305 |
Q |
|
|
|||||||||||||| || |||||| |
|
|
T |
7805695 |
tgatgaattctatacaggttgatg |
7805672 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University