View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0885_low_25 (Length: 328)
Name: NF0885_low_25
Description: NF0885
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0885_low_25 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 151; Significance: 7e-80; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 151; E-Value: 7e-80
Query Start/End: Original strand, 100 - 258
Target Start/End: Complemental strand, 28613596 - 28613438
Alignment:
Q |
100 |
tcaacatcaaacatgccaaaaatgtcacaaacacaatttatgacagaaacttgcaagctgcagtgagttaaagtgaagacaagatatgtctcaaatgttg |
199 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
T |
28613596 |
tcaacatcaaacatgccaaaaatgtcacaaacacaatttatgacagaaacttgcaagctgaagtgagttaaagtgaagacaagatatgtctcaaatgttg |
28613497 |
T |
 |
Q |
200 |
tagtagtttcttactttcttgtcttttcgccgttttcactgtacctttgcttctcctct |
258 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
T |
28613496 |
tagtagtttcttactttcttgtcttttcgccgttttcactgtacctttgcttctactct |
28613438 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University