View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0885_low_28 (Length: 296)
Name: NF0885_low_28
Description: NF0885
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0885_low_28 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 176; Significance: 8e-95; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 176; E-Value: 8e-95
Query Start/End: Original strand, 105 - 288
Target Start/End: Original strand, 6486678 - 6486861
Alignment:
| Q |
105 |
ggagagaccttccagggtcgtagtagtaagggctcatgggggaggcggcgctgctgctacgcatggcatagtcatcgtcagtataggcttctgttgtgga |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6486678 |
ggagagaccttccagggtcgtagtagtaagggctcatgggggaggcggcgctgctgctacgcatggcatagtcatcgtcagtataggcttctgttgtgga |
6486777 |
T |
|
| Q |
205 |
aaatcggggttcggattgcataaactgtggacgaggaatgttattattgttgttgctgctgccattgctgctgctatctctgct |
288 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
6486778 |
aaatcggggttcggattgcataaactgtggacgaggaatgttattgttgttgttgctgctgccattgctgctgctatttctgct |
6486861 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 1 - 44
Target Start/End: Original strand, 6486573 - 6486616
Alignment:
| Q |
1 |
aaagaatccaaatagctcgtctagtgagctaagggtcatcgaac |
44 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6486573 |
aaagaatccaaatagctcgtctagtgagctaagggtcatcgaac |
6486616 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 189 times since January 2019
Visitors: 6713