View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0885_low_30 (Length: 289)
Name: NF0885_low_30
Description: NF0885
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0885_low_30 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 163; Significance: 4e-87; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 163; E-Value: 4e-87
Query Start/End: Original strand, 9 - 191
Target Start/End: Original strand, 7423957 - 7424139
Alignment:
| Q |
9 |
tatacaatccaattctattttgttttaaacttttgatttataggtgaagagaactttggtaatatagagtttcatcgtgagataaatattattcgatcaa |
108 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||| |
|
|
| T |
7423957 |
tatacaatccaattctattttattttaaacttttgatttataggtgaagagaactttggtaatgtagagtttgatcgtgagataaatattattcgatcaa |
7424056 |
T |
 |
| Q |
109 |
taactgtttgatatgtaagttaaattcaatttatttttattttaaaccattcattgatagtgaagtttattaacaagctgaat |
191 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
7424057 |
taactgtttgatatgtaagttaaactcaatttatttttattttaaaccattcattgatagtgaagtttattaaccagctgaat |
7424139 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University