View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0885_low_31 (Length: 289)
Name: NF0885_low_31
Description: NF0885
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0885_low_31 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 180; Significance: 3e-97; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 180; E-Value: 3e-97
Query Start/End: Original strand, 1 - 200
Target Start/End: Complemental strand, 7423973 - 7423775
Alignment:
| Q |
1 |
tagaattggattgtataagtaaagtacggatgagagaacgtgcacttttgactcctgttatttggtctgtctgcttatattattattggaaccaattatt |
100 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7423973 |
tagaattggattgtata-gtaaagtacggatgagagaacgtgcacttttgactcctgttatttggtctgtctgcttatattattattggaaccaattatt |
7423875 |
T |
 |
| Q |
101 |
agtggtcttaaataaattactacatttttggggcgcttcacgtgctacatgaataattaaccatagactttttattatttcatctcattgtgatgatgtc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||| |||||||| |
|
|
| T |
7423874 |
agtggtcttaaataaattactacatttttggggcgcttcacgtgctacatgaataattaaccatagactttttattatctcatttcattgttatgatgtc |
7423775 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University