View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0885_low_35 (Length: 284)

Name: NF0885_low_35
Description: NF0885
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0885_low_35
NF0885_low_35
[»] chr2 (1 HSPs)
chr2 (1-162)||(8187909-8188070)


Alignment Details
Target: chr2 (Bit Score: 162; Significance: 2e-86; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 162; E-Value: 2e-86
Query Start/End: Original strand, 1 - 162
Target Start/End: Complemental strand, 8188070 - 8187909
Alignment:
1 acctgccgcttctaaaacaatttcctcctcgccatgttcagaatctactgcactacagatttgctcattatccgttatcttttccaaatctatatccata 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
8188070 acctgccgcttctaaaacaatttcctcctcgccatgttcagaatctactgcactacagatttgctcattatccgttatcttttccaaatctatatccata 8187971  T
101 gatggcccactatctacaacattacgatccaatccatcaccttcagaactcaaacttgatga 162  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
8187970 gatggcccactatctacaacattacgatccaatccatcaccttcagaactcaaacttgatga 8187909  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University