View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0885_low_35 (Length: 284)
Name: NF0885_low_35
Description: NF0885
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0885_low_35 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 162; Significance: 2e-86; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 162; E-Value: 2e-86
Query Start/End: Original strand, 1 - 162
Target Start/End: Complemental strand, 8188070 - 8187909
Alignment:
| Q |
1 |
acctgccgcttctaaaacaatttcctcctcgccatgttcagaatctactgcactacagatttgctcattatccgttatcttttccaaatctatatccata |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8188070 |
acctgccgcttctaaaacaatttcctcctcgccatgttcagaatctactgcactacagatttgctcattatccgttatcttttccaaatctatatccata |
8187971 |
T |
 |
| Q |
101 |
gatggcccactatctacaacattacgatccaatccatcaccttcagaactcaaacttgatga |
162 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8187970 |
gatggcccactatctacaacattacgatccaatccatcaccttcagaactcaaacttgatga |
8187909 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University