View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0885_low_39 (Length: 260)
Name: NF0885_low_39
Description: NF0885
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0885_low_39 |
 |  |
|
[»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 22 - 260
Target Start/End: Complemental strand, 37859624 - 37859386
Alignment:
Q |
22 |
catcatcatcaacaatgaatgtgnnnnnnntgacacaaaatctagctggagtttccttcaagctttaacagaaactaacaaaactgaaaatgcaaatggt |
121 |
Q |
|
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
T |
37859624 |
catcatcatcaacaatgaatgtgaaaaaaatgacacaaaatctagctggagtttccttcaagctttaacagaaactaacaaaattgaaaatgcaaatggt |
37859525 |
T |
 |
Q |
122 |
aaagtctatgttcatcctactgtgaaacgttcctcatcaatgctaagtgaaaagagcttagaaatgtgcactgaaagccttgggagtgaaactggtagca |
221 |
Q |
|
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
37859524 |
aacgtctatgttcatcctactgtgaaacgttcctcatcaatgctaagtgaaaagagcttagaaatgtgcactgaaagccttgggagtgaaactggtagca |
37859425 |
T |
 |
Q |
222 |
atgctggtgaaagtagagatattgatgtttcattatttt |
260 |
Q |
|
|
|||||||||||||||| |||||||||||||||||||||| |
|
|
T |
37859424 |
atgctggtgaaagtagtgatattgatgtttcattatttt |
37859386 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 461 times since January 2019
Visitors: 6704