View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0885_low_42 (Length: 251)
Name: NF0885_low_42
Description: NF0885
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0885_low_42 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 28 - 251
Target Start/End: Complemental strand, 26813740 - 26813517
Alignment:
| Q |
28 |
cagtattgataacatttattgtttaaacatattaaagtggctacataacctgaaactacctcaatccactctcactcactcacccctcttacatctttgc |
127 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26813740 |
cagtattgataacatttattgtttaaacatattaaagtggctacataacctgaaactacctcaatccactctcactcactcacccctcttacatctttgc |
26813641 |
T |
|
| Q |
128 |
ctaattcctcatccattttcttttccaaatatctctccttgcaatcatgaaaatagatcataaaaaccacccatttcaatggaatcaccatgcagaacaa |
227 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26813640 |
ctaattcctcatccattttcttttccaaatatctctccttgcaatcatgaaaatagatcataaaaaccacccatttcaatggaatcaccatgcagaacaa |
26813541 |
T |
|
| Q |
228 |
tccaacttgtatgaaaattccatt |
251 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
26813540 |
tccaacttgtatgaaaattccatt |
26813517 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 433 times since January 2019
Visitors: 6714