View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0885_low_44 (Length: 234)
Name: NF0885_low_44
Description: NF0885
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0885_low_44 |
 |  |
|
[»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 136; Significance: 4e-71; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 136; E-Value: 4e-71
Query Start/End: Original strand, 99 - 234
Target Start/End: Original strand, 26813380 - 26813515
Alignment:
Q |
99 |
gtattgatgcattagtactttcacttaatttcagcagagggtgccaaagaaaagggctttttctgatgttgattttctttgcatggggacagtttttgag |
198 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
26813380 |
gtattgatgcattagtactttcacttaatttcagcagagggtgccaaagaaaagggctttttctgatgttgattttctttgcatggggacagtttttgag |
26813479 |
T |
 |
Q |
199 |
atttttctgctactatgttggaggctatgaacaagg |
234 |
Q |
|
|
|||||||||||||||||||||||||||||||||||| |
|
|
T |
26813480 |
atttttctgctactatgttggaggctatgaacaagg |
26813515 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University