View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0885_low_44 (Length: 234)

Name: NF0885_low_44
Description: NF0885
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0885_low_44
NF0885_low_44
[»] chr8 (1 HSPs)
chr8 (99-234)||(26813380-26813515)


Alignment Details
Target: chr8 (Bit Score: 136; Significance: 4e-71; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 136; E-Value: 4e-71
Query Start/End: Original strand, 99 - 234
Target Start/End: Original strand, 26813380 - 26813515
Alignment:
99 gtattgatgcattagtactttcacttaatttcagcagagggtgccaaagaaaagggctttttctgatgttgattttctttgcatggggacagtttttgag 198  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
26813380 gtattgatgcattagtactttcacttaatttcagcagagggtgccaaagaaaagggctttttctgatgttgattttctttgcatggggacagtttttgag 26813479  T
199 atttttctgctactatgttggaggctatgaacaagg 234  Q
    ||||||||||||||||||||||||||||||||||||    
26813480 atttttctgctactatgttggaggctatgaacaagg 26813515  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University