View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0885_low_45 (Length: 227)
Name: NF0885_low_45
Description: NF0885
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0885_low_45 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 1 - 206
Target Start/End: Original strand, 31607538 - 31607743
Alignment:
Q |
1 |
tctctatggtccttatgggtctggcttattgtatagttattttgatgataatataggtcaaggaatcaagcaaatgtggtaccaattattaggagcagtt |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
31607538 |
tctctatggtccttatgggtctggcttattgtatagttattttgatgataatataggtcaaggaatcaagcaaatgtggtaccaattattaggagcagtt |
31607637 |
T |
 |
Q |
101 |
tttattactatttggaatgttgttattactagtctgatttgtattcttttaaatcgctttgtgaatcttcgaatgcaagaagaagagcttgaggttggtg |
200 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
T |
31607638 |
tttattactatttggaatgttgttattactagtctgatttgtattcttttaaatcgctttgtgaatcttcgaatgcaagaagaagaccttgaggttggtg |
31607737 |
T |
 |
Q |
201 |
atgatg |
206 |
Q |
|
|
|||||| |
|
|
T |
31607738 |
atgatg |
31607743 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University