View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0885_low_47 (Length: 206)
Name: NF0885_low_47
Description: NF0885
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0885_low_47 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 115; Significance: 1e-58; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 115; E-Value: 1e-58
Query Start/End: Original strand, 1 - 119
Target Start/End: Original strand, 6319822 - 6319940
Alignment:
| Q |
1 |
ttaagcgaagatgatggcgatcacaaaacaggcatattgagtggtatgagtagcccttcaagcggcgatgatgatcgcaaaaggcagtcaatactatcag |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
6319822 |
ttaagcgaagatgatggcgatcacaaaacaggcatattgagtggtatgagtagcccttcaagcggcgatgatgatcgcaaaaggcagtcaatactgtcag |
6319921 |
T |
|
| Q |
101 |
ctgatcaagaaactgatga |
119 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
6319922 |
ctgatcaagaaactgatga |
6319940 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 575 times since January 2019
Visitors: 6718