View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0886_high_15 (Length: 272)

Name: NF0886_high_15
Description: NF0886
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0886_high_15
NF0886_high_15
[»] chr2 (1 HSPs)
chr2 (30-249)||(17608136-17608355)


Alignment Details
Target: chr2 (Bit Score: 163; Significance: 4e-87; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 163; E-Value: 4e-87
Query Start/End: Original strand, 30 - 249
Target Start/End: Original strand, 17608136 - 17608355
Alignment:
30 cattcaacacttgtctcacacatagctccttacccttcatatgtgtatgnnnnnnnnagaagggtcacgttcttctcttgnnnnnnngtcacaatcattt 129  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||        |||||||||||||||||||||||       |||||||||||||    
17608136 cattcaacacttgtctcacacatagctccttacccttcatatgtgtatgttttttttagaagggtcacgttcttctcttgtttttttgtcacaatcattt 17608235  T
130 caaactaaggaagagaaaagagagaaaagaggaggaaggggttttggattttgatatggagaataatcacatggtgaaggaggaaatgctagatgaagaa 229  Q
    |||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||    
17608236 caaattaaggaagagaaaagagagaaaagaggaggaaggggttttggattttggtatggagaataatcacatggtgaaggaggaaatggtagatgaagaa 17608335  T
230 gaagtggtggaacatgatga 249  Q
    ||||||||||||||||||||    
17608336 gaagtggtggaacatgatga 17608355  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 825 times since January 2019
Visitors: 6719