View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0886_high_15 (Length: 272)
Name: NF0886_high_15
Description: NF0886
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0886_high_15 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 163; Significance: 4e-87; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 163; E-Value: 4e-87
Query Start/End: Original strand, 30 - 249
Target Start/End: Original strand, 17608136 - 17608355
Alignment:
Q |
30 |
cattcaacacttgtctcacacatagctccttacccttcatatgtgtatgnnnnnnnnagaagggtcacgttcttctcttgnnnnnnngtcacaatcattt |
129 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||| |
|
|
T |
17608136 |
cattcaacacttgtctcacacatagctccttacccttcatatgtgtatgttttttttagaagggtcacgttcttctcttgtttttttgtcacaatcattt |
17608235 |
T |
 |
Q |
130 |
caaactaaggaagagaaaagagagaaaagaggaggaaggggttttggattttgatatggagaataatcacatggtgaaggaggaaatgctagatgaagaa |
229 |
Q |
|
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
T |
17608236 |
caaattaaggaagagaaaagagagaaaagaggaggaaggggttttggattttggtatggagaataatcacatggtgaaggaggaaatggtagatgaagaa |
17608335 |
T |
 |
Q |
230 |
gaagtggtggaacatgatga |
249 |
Q |
|
|
|||||||||||||||||||| |
|
|
T |
17608336 |
gaagtggtggaacatgatga |
17608355 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University