View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0886_high_16 (Length: 272)
Name: NF0886_high_16
Description: NF0886
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0886_high_16 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 110; Significance: 2e-55; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 114 - 227
Target Start/End: Original strand, 8931362 - 8931475
Alignment:
Q |
114 |
tcattcccaataccttcaacaacaccaacaccattcacaatttcttctttttcattaataccattatcaccaacataatcaaaactacttttttcaccaa |
213 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
8931362 |
tcattcccaataccttcaacaacaccaacaccattcacaatttcttctttttcattaataccattatcaccaacataatcaaaactacttttttcaccaa |
8931461 |
T |
 |
Q |
214 |
acttatctttattt |
227 |
Q |
|
|
||||||||| |||| |
|
|
T |
8931462 |
acttatcttcattt |
8931475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 982 times since January 2019
Visitors: 6719