View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0886_high_19 (Length: 260)
Name: NF0886_high_19
Description: NF0886
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0886_high_19 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 21 - 250
Target Start/End: Complemental strand, 45439412 - 45439183
Alignment:
Q |
21 |
acatcatcatttaagtttataatgtttgatttgtgttttgatatatgattatcgaggaattcatacctggacaatccgttcttggtgaacttaattcccc |
120 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
45439412 |
acatcatcatttaagtttataatgtttgatttgtgttttggtatatgattatcgaggaattcatacctggacaatccgttcttggtgaacttaattcccc |
45439313 |
T |
 |
Q |
121 |
aacaatatcctcaaatgtcccagcccatgcatctctgtgagtcaaaaagttagaggaaaggttgaacatcttctttatggtggctggaattgaagagtgc |
220 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
T |
45439312 |
aacaatatcctcaaatgtcccagcccatgcatctctgtgagtcaaaaagttagaggaaaggttgaacatcttctttatggtggcaggaattgaagagtgc |
45439213 |
T |
 |
Q |
221 |
tcaaactcggaattcgcagctggtcctttg |
250 |
Q |
|
|
|||||||||||||||||||||||||||||| |
|
|
T |
45439212 |
tcaaactcggaattcgcagctggtcctttg |
45439183 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 816 times since January 2019
Visitors: 6719