View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0886_high_22 (Length: 251)
Name: NF0886_high_22
Description: NF0886
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0886_high_22 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 110; Significance: 2e-55; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 33 - 142
Target Start/End: Complemental strand, 47534773 - 47534664
Alignment:
| Q |
33 |
ggttatgcacattatatcaacttgactgtatttaagttgctatagaggaatccaaagatttatccaacatgaaaattgaagatctgtaatgcttgttgga |
132 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47534773 |
ggttatgcacattatatcaacttgactgtatttaagttgctatagaggaatccaaagatttatccaacatgaaaattgaagatctgtaatgcttgttgga |
47534674 |
T |
 |
| Q |
133 |
agcaaatgag |
142 |
Q |
| |
|
|||||||||| |
|
|
| T |
47534673 |
agcaaatgag |
47534664 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 141 - 251
Target Start/End: Complemental strand, 47534403 - 47534293
Alignment:
| Q |
141 |
agtgatatagattgtgatccaatactgctcatggcgactaaaaatagtggacttgggagcactgatggatggtacttggatacaggacgctccagccacg |
240 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47534403 |
agtgatatagattatgatccaatactgctcatggcgactaaaaatagtggacttgggagcactgatggatggtacttggatacaggacgctccagccacg |
47534304 |
T |
 |
| Q |
241 |
atagtagaaca |
251 |
Q |
| |
|
| ||||||||| |
|
|
| T |
47534303 |
acagtagaaca |
47534293 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University