View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0886_high_23 (Length: 251)
Name: NF0886_high_23
Description: NF0886
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0886_high_23 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 189; Significance: 1e-102; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 44 - 248
Target Start/End: Complemental strand, 38983106 - 38982902
Alignment:
Q |
44 |
tcttatttttgttattttagtagtaagtggtgtgtaaaatcaaccaaatcaatccactccaaaaagctaaaactattttttaacatacattttataggtt |
143 |
Q |
|
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
T |
38983106 |
tcttatttttgttattttagtagtaagtggtgagtaaaatcaaccaaatcaatccactccaaaaaactaaaactattttttaacatacattttataggtg |
38983007 |
T |
 |
Q |
144 |
aacatatgcagtgagacgacagttgctaattatctttcagacaccatggttcataggggcagcttgcttagtaataacaatctgacaaatgtgcaaagtc |
243 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
38983006 |
aacatatgcagtgagacgacagttgctaattatctttcagataccatggttcataggggcagcttgcttagtaataacaatctgacaaatgtgcaaagtc |
38982907 |
T |
 |
Q |
244 |
ttatg |
248 |
Q |
|
|
||||| |
|
|
T |
38982906 |
ttatg |
38982902 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 216 - 250
Target Start/End: Original strand, 39909361 - 39909395
Alignment:
Q |
216 |
aataacaatctgacaaatgtgcaaagtcttatggc |
250 |
Q |
|
|
|||||||| |||||||||||||||||||||||||| |
|
|
T |
39909361 |
aataacaacctgacaaatgtgcaaagtcttatggc |
39909395 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University