View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0886_high_25 (Length: 250)
Name: NF0886_high_25
Description: NF0886
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0886_high_25 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 8 - 238
Target Start/End: Complemental strand, 28820650 - 28820421
Alignment:
Q |
8 |
gatgaaacgtccatgctgatgaatacttgtcaggatgaactcaacagtcttcatggaaatgaaggtatgcataatgttatgcattcttctctttagtatt |
107 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
28820650 |
gatgaaacgtccatgctgatgaatacttgtcaggatgaactcaacagtcttcacggaaatgaaggtatgcataatgttatgcattcttctctttagtatt |
28820551 |
T |
 |
Q |
108 |
gtttgaattttgattccaatggtcaatagtctagattgtctagctaaacttaaaggaacttgccactacttattatgttatatgatgttactgattcagc |
207 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
T |
28820550 |
gtttgaattttgattccaatggtcaatagtctagattgtctagctaaacttaaaggaacttgccactacttattatgttatatgatg-tactgattcagc |
28820452 |
T |
 |
Q |
208 |
tgacattggatcaaaggggatcagcaacagc |
238 |
Q |
|
|
||||||||||||||||||||||||||||||| |
|
|
T |
28820451 |
tgacattggatcaaaggggatcagcaacagc |
28820421 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University