View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0886_high_25 (Length: 250)

Name: NF0886_high_25
Description: NF0886
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0886_high_25
NF0886_high_25
[»] chr1 (1 HSPs)
chr1 (8-238)||(28820421-28820650)


Alignment Details
Target: chr1 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 8 - 238
Target Start/End: Complemental strand, 28820650 - 28820421
Alignment:
8 gatgaaacgtccatgctgatgaatacttgtcaggatgaactcaacagtcttcatggaaatgaaggtatgcataatgttatgcattcttctctttagtatt 107  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||    
28820650 gatgaaacgtccatgctgatgaatacttgtcaggatgaactcaacagtcttcacggaaatgaaggtatgcataatgttatgcattcttctctttagtatt 28820551  T
108 gtttgaattttgattccaatggtcaatagtctagattgtctagctaaacttaaaggaacttgccactacttattatgttatatgatgttactgattcagc 207  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||    
28820550 gtttgaattttgattccaatggtcaatagtctagattgtctagctaaacttaaaggaacttgccactacttattatgttatatgatg-tactgattcagc 28820452  T
208 tgacattggatcaaaggggatcagcaacagc 238  Q
    |||||||||||||||||||||||||||||||    
28820451 tgacattggatcaaaggggatcagcaacagc 28820421  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 707 times since January 2019
Visitors: 6719