View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0886_high_29 (Length: 240)
Name: NF0886_high_29
Description: NF0886
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0886_high_29 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 168; Significance: 4e-90; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 168; E-Value: 4e-90
Query Start/End: Original strand, 25 - 240
Target Start/End: Original strand, 16506793 - 16507007
Alignment:
| Q |
25 |
ggtgactcaggatagtggagtagagttgatggtgaggtggttaggtgtttatgaggctgctgcagtgaaggagtgtaaggacgagtttggtgcttatatt |
124 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
16506793 |
ggtgactcaggatagtggagtagagttgatggtgaggtggttaggtgtttctgaggctgctgcagtgaaggagtgcaaggacgagtttggtgcttatatt |
16506892 |
T |
 |
| Q |
125 |
acttaaacttggctgaagcaactttatgaggaacactttaatttagccattagattggcggtgccacagacaagggaggagttagaggggagaaataggc |
224 |
Q |
| |
|
|||||||||||| ||||||||||||||||||| ||||||| ||||| | |||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
16506893 |
acttaaacttggttgaagcaactttatgaggattactttaa-ttagctactagattggcggtgccacagacaagggaggagttagaggagagaaataggc |
16506991 |
T |
 |
| Q |
225 |
gtatgtagggttgtgt |
240 |
Q |
| |
|
||||| || ||||||| |
|
|
| T |
16506992 |
gtatgcagtgttgtgt |
16507007 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 43; Significance: 0.000000000000001; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 25 - 155
Target Start/End: Complemental strand, 390837 - 390707
Alignment:
| Q |
25 |
ggtgactcaggatagtggagtagagttgatggtgaggtggttaggtgtttatgaggctgctgcagtgaaggagtgtaaggacgagtttggtgcttatatt |
124 |
Q |
| |
|
|||| ||||||| ||||||| ||||||||||| |||| |||||||||| ||| || ||||||||||| ||| ||||| ||||||| ||| |||||| |
|
|
| T |
390837 |
ggtgtctcaggagcgtggagtggagttgatggtccggtgtttaggtgtttcgaaggttgttgcagtgaaggcgtgcaaggatgagtttgatgcatatatt |
390738 |
T |
 |
| Q |
125 |
acttaaacttggctgaagcaactttatgagg |
155 |
Q |
| |
|
||||| || | ||||||| | |||||||||| |
|
|
| T |
390737 |
acttatacctcgctgaaggagctttatgagg |
390707 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 25 - 74
Target Start/End: Original strand, 11325468 - 11325517
Alignment:
| Q |
25 |
ggtgactcaggatagtggagtagagttgatggtgaggtggttaggtgttt |
74 |
Q |
| |
|
||||| || |||| |||||||| | ||||||||||||||||||||||||| |
|
|
| T |
11325468 |
ggtgagtcgggatcgtggagtacaattgatggtgaggtggttaggtgttt |
11325517 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 52 - 156
Target Start/End: Complemental strand, 47849340 - 47849236
Alignment:
| Q |
52 |
gatggtgaggtggttaggtgtttatgaggctgctgcagtgaaggagtgtaaggacgagtttggtgcttatattacttaaacttggctgaagcaactttat |
151 |
Q |
| |
|
|||||||||| |||||||||||| |||||| || || | || ||||| |||||| ||||||||||| |||| ||||| |||||||| || |||||||| |
|
|
| T |
47849340 |
gatggtgaggaggttaggtgtttctgaggcgcctacaattaaagagtgcaaggacaagtttggtgctcatataacttatacttggcttaatgaactttat |
47849241 |
T |
 |
| Q |
152 |
gagga |
156 |
Q |
| |
|
||||| |
|
|
| T |
47849240 |
gagga |
47849236 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University