View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0886_high_32 (Length: 214)
Name: NF0886_high_32
Description: NF0886
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0886_high_32 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 1 - 198
Target Start/End: Original strand, 49511013 - 49511210
Alignment:
Q |
1 |
tatacggaacagaaccatctagaaaatgtgcatcttggtaaagagtaatttggcaaccattattttgtttaaagaatgtgcgaggaactccttgatatcc |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
49511013 |
tatacggaacagaaccatctagaaaatgtgcatcttggtaaagagtaatttggcaaccattattttgtttaaagaatgtgcgaggaactccttgatatcc |
49511112 |
T |
 |
Q |
101 |
tggactctttattccttgtgaccagtttggatcatttttaacatgtgagaattgtatttgaacatgaattttggaaccgccttgtattggatgatgat |
198 |
Q |
|
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
49511113 |
tggactctttagtccttgtgaccagtttggatcatttttaacatgtgagaattgtatttgaacatgaattttggaaccgccttgtattggatgatgat |
49511210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University