View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0886_low_10 (Length: 409)
Name: NF0886_low_10
Description: NF0886
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0886_low_10 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 181; Significance: 1e-97; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 181; E-Value: 1e-97
Query Start/End: Original strand, 170 - 357
Target Start/End: Complemental strand, 35443393 - 35443205
Alignment:
| Q |
170 |
ctctaatatttgcgatacgtcaagtggatccgcaatgcatactcttattactcgtcaagatgttgaccaggtaattaattgacctctctctaatgatatg |
269 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35443393 |
ctctaatatttgcgatacgtcaagtggatccgcaatgcatactcttattactcgtcaagatgttgaccaggtaattaattgacctctctctaatgatatg |
35443294 |
T |
 |
| Q |
270 |
atacacttcactcattgttgatttagaatagaattttgcgaaaataaacaaaggaatcacctttgttctttacctt-ttttatgtttgt |
357 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
35443293 |
atacacttcactcattgttgatttagaatagaattttgcgaaaataaacaaaggaatcacctttgttctttacctttttttatgtttgt |
35443205 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 355 - 409
Target Start/End: Complemental strand, 35443146 - 35443092
Alignment:
| Q |
355 |
tgtatatttgtatagattgcatttcttctcgtggttttatgcagttggaaatttt |
409 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35443146 |
tgtatatttgtatagattgcatttcttctcgtggttttatgcagttggaaatttt |
35443092 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University