View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0886_low_20 (Length: 321)
Name: NF0886_low_20
Description: NF0886
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0886_low_20 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 259; Significance: 1e-144; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 259; E-Value: 1e-144
Query Start/End: Original strand, 23 - 297
Target Start/End: Complemental strand, 48833528 - 48833254
Alignment:
Q |
23 |
atcatcaagtttcaggctttcaacgagaatgctttcctgaagtatttggagtagttagttcatgtcatgttgattctggcacttattcaaccaacaaatt |
122 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| | |
|
|
T |
48833528 |
atcatcaagtttcaggctttcaacgagaatgctttcctgaagtatttggagtagttagttcatgtcatgttgattctggcacttattcaagcaacaaaat |
48833429 |
T |
 |
Q |
123 |
aagcatattttgacagtcaaccttcaattatccaaaggaacaaaagacatcactagcaggctcgtttaaaattgcacatatttaccaacaaattcgaaaa |
222 |
Q |
|
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
48833428 |
aagcatattttgacattcaaccttcaattatccaaaggaacaaaagacatcactagcaggctcgtttaaaattgcacatatttaccaacaaattcgaaaa |
48833329 |
T |
 |
Q |
223 |
tatctttcaagctatcaagtttaatattttatcagaataacagacaccaaatcaaccaagcactgagatttgatg |
297 |
Q |
|
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
48833328 |
tatctttcaagctattaagtttaatattttatcagaataacagacaccaaatcaaccaagcactgagatttgatg |
48833254 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University