View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0886_low_23 (Length: 319)
Name: NF0886_low_23
Description: NF0886
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0886_low_23 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 114; Significance: 8e-58; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 114; E-Value: 8e-58
Query Start/End: Original strand, 198 - 319
Target Start/End: Original strand, 36690838 - 36690959
Alignment:
| Q |
198 |
aatggtgtcattccacttgagtggaggaacaccaacctcggcacgataaggggatcaatacaacaggatcttacaaatatgtttggatacatgacaccta |
297 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36690838 |
aatggtgtcattccacttgagtggaggaacaccaacctcggcacgataaggggatcaatacaacaggatcttacaaatatgtttggatacatgacaccta |
36690937 |
T |
 |
| Q |
298 |
ccaggtaggttaattaataagt |
319 |
Q |
| |
|
|||| |||||||||| |||||| |
|
|
| T |
36690938 |
ccagataggttaattgataagt |
36690959 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University