View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0886_low_31 (Length: 287)
Name: NF0886_low_31
Description: NF0886
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0886_low_31 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 258; Significance: 1e-144; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 258; E-Value: 1e-144
Query Start/End: Original strand, 1 - 266
Target Start/End: Original strand, 5374492 - 5374757
Alignment:
| Q |
1 |
tcttttacctcactctagacaacaaagtcaagtaatcattggtattcttgacactggtatatggccagagctaaaaagcttagatgacacaggactaggt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5374492 |
tcttttacctcactctagacaacaaagtcaagtaatcattggtattcttgacactggtatatggccagagctaaaaagcttagatgacacaggactaggt |
5374591 |
T |
|
| Q |
101 |
ccaataccaagtaattggaaaggtgtatgtgaaactggtaacaacatgagttcgtcacactgcaacaaaaaactcataggtgcaaggtttttcttaaaag |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5374592 |
ccaataccaagtaattggaaaggtgtatgtgaaactggtaacaacatgaattcatcacactgcaacaaaaaactcataggtgcaaggtttttcttaaaag |
5374691 |
T |
|
| Q |
201 |
ggtatgaagcagcacttggtccaatagatgaaacaacagaatcaaaatcagctagagatgatgatg |
266 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5374692 |
ggtatgaagcagcacttggtccaatagatgaaacaacagaatcaaaatcagctagagatgatgatg |
5374757 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 775 times since January 2019
Visitors: 6719