View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0886_low_32 (Length: 277)
Name: NF0886_low_32
Description: NF0886
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0886_low_32 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 165; Significance: 3e-88; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 165; E-Value: 3e-88
Query Start/End: Original strand, 45 - 238
Target Start/End: Complemental strand, 38480544 - 38480351
Alignment:
| Q |
45 |
catcatcatattaatgtcactaaaagaagaaggcacaccagtattacaacttttgtaaacaatattaagagagataaatgtcaagaatgtgttggactgc |
144 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
38480544 |
catcatcatattaatgtcactaaaagaagaaggcacaccagtattacaacttttgtaaacaatattaagagagataaatttcaagaatgtgttggactgc |
38480445 |
T |
|
| Q |
145 |
aataataccatcttccnnnnnnnctaagggatataatgatatatggggaaagcactaaccctctcaaatgagttccattctttaggttcatctc |
238 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
38480444 |
aataataccatcttccaaaaaaactaagggatataatgatatatggggaaagcactaaccctctcaaatgagttccattctttaggttcttctc |
38480351 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 299 times since January 2019
Visitors: 6714