View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0886_low_38 (Length: 270)
Name: NF0886_low_38
Description: NF0886
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0886_low_38 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 30 - 243
Target Start/End: Original strand, 37214898 - 37215111
Alignment:
Q |
30 |
gatatcattggctgagttaaatagattaacaggaaactttggttcaaaggccttcattggtgaaggttcgtatggaagggtttactatgcaaaaatgaat |
129 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
37214898 |
gatatcattggctgagttaaatagattaacaggaaactttggttcaaaggccttcattggtgaaggttcgtatggaagggtttactatgcaaaaatgaat |
37214997 |
T |
 |
Q |
130 |
gatggtactgaagctgcaatcaaaaggctggatacaagttcttcacctgattccgactccaacgatttcgcggctcaggtaagnnnnnnntatttaaagc |
229 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
T |
37214998 |
gatggtactgaagctgcaatcaaaaggctggatacaagttcttcacctgattccgactccaacgatttcgcggctcaggtaagaaaaaattatttaaagc |
37215097 |
T |
 |
Q |
230 |
aatgatttggctct |
243 |
Q |
|
|
|||||||||||||| |
|
|
T |
37215098 |
aatgatttggctct |
37215111 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 64 - 121
Target Start/End: Original strand, 52717091 - 52717148
Alignment:
Q |
64 |
aactttggttcaaaggccttcattggtgaaggttcgtatggaagggtttactatgcaa |
121 |
Q |
|
|
|||||||| |||||||| || ||||||||||| |||||||| ||||| || ||||||| |
|
|
T |
52717091 |
aactttggatcaaaggcattgattggtgaagggtcgtatgggagggtgtattatgcaa |
52717148 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University