View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0886_low_49 (Length: 252)
Name: NF0886_low_49
Description: NF0886
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0886_low_49 |
 |  |
|
| [»] chr5 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 208; Significance: 1e-114; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 41 - 252
Target Start/End: Complemental strand, 37444331 - 37444120
Alignment:
| Q |
41 |
gacttcaagattgttgtgcttttttgttgtttttcaatggaaattattaatgctttatattttggtctgagagtgtgaggaacatttttaatattagcag |
140 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37444331 |
gacttcaagattgttgtgcttttttgttgtttttcaatggaaattattaatgctttatattttggtctgagagtgtgaggaacatttttaatattagcag |
37444232 |
T |
 |
| Q |
141 |
cgagggtttgacaaattacttgtttaaaaacattgacttagctagggtaactgttgttaaaaggaggattgagtgagcgatggtgcaaaagagagggtag |
240 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37444231 |
tgagggtttgacaaattacttgtttaaaaacattgacttagctagggtaactgttgttaaaaggaggattgagtgagcgatggtgcaaaagagagggtag |
37444132 |
T |
 |
| Q |
241 |
agtgagtgaaac |
252 |
Q |
| |
|
|||||||||||| |
|
|
| T |
37444131 |
agtgagtgaaac |
37444120 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 170 - 241
Target Start/End: Original strand, 7492522 - 7492593
Alignment:
| Q |
170 |
acattgacttagctagggtaactgttgttaaaaggaggattgagtgagcgatggtgcaaaagagagggtaga |
241 |
Q |
| |
|
|||||||||| |||| | || |||||||||||||||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
7492522 |
acattgacttggctaagatagctgttgttaaaaggaggattgagtgagcaatggtgcaaaagagaggataga |
7492593 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University