View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0886_low_52 (Length: 251)
Name: NF0886_low_52
Description: NF0886
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0886_low_52 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 1 - 240
Target Start/End: Original strand, 12036006 - 12036245
Alignment:
| Q |
1 |
atgaccaagagattgattaacttaaaactttaatggcgattttagaagagaatgagatcatgaaagttatggtttttggagtgaaatttctgtaggtaat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||| |
|
|
| T |
12036006 |
atgaccaagagattgattaacttaaaactttaatggcgattttagaagagaatgagatcatgaaagttagggtttttggagtgaaatttgtgtaggtaat |
12036105 |
T |
|
| Q |
101 |
tttttagacaaagggttgattgatcttcacaaggtattacatggttgtaagttttatatgaaaaatgaagagggtttcaaggctgatcttcataaataat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12036106 |
tttttagacaaagggttgattgatcttcacaaggtattacatggttgtaagttttatatgaaaaatgaagagggtttcaaggctgatcttcataaataat |
12036205 |
T |
|
| Q |
201 |
tgtctattaagcaacttaacttaagattcatgcttttcat |
240 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
12036206 |
tgtctatcaagcaacttaacttaagattcatgcttttcat |
12036245 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 814 times since January 2019
Visitors: 6719