View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0886_low_54 (Length: 251)
Name: NF0886_low_54
Description: NF0886
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0886_low_54 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 30 - 251
Target Start/End: Complemental strand, 34432007 - 34431786
Alignment:
| Q |
30 |
ggagatggagattctgtgatgattggtggtggtgttcaagttcaaccagaaatggagataagatttgatgggcatttggtggttcatgtgaagcacttgc |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34432007 |
ggagatggagattctgtgatgattggtggtggtgttcaagttcaaccagaaatggagataagatttgatgggcatttggtggttcatgtgaagcacttgc |
34431908 |
T |
|
| Q |
130 |
aatggaaatttagagggaatgaattgattcatctcaacaaaatgagagttgaggtatattgggatgttcatgattggttatttagtcctggtttaaaaca |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34431907 |
aatggaaatttagagggaatgaattgattcatctcaacaaaatgagagttgaggtatattgggatgttcatgattggttatttagtcctggtttaaaaca |
34431808 |
T |
|
| Q |
230 |
tgctttgttcatttttaagcct |
251 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
34431807 |
tgctttgttcatttttaagcct |
34431786 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 107; Significance: 1e-53; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 107; E-Value: 1e-53
Query Start/End: Original strand, 68 - 250
Target Start/End: Complemental strand, 43402926 - 43402744
Alignment:
| Q |
68 |
agttcaaccagaaatggagataagatttgatgggcatttggtggttcatgtgaagcacttgcaatggaaatttagagggaatgaattgattcatctcaac |
167 |
Q |
| |
|
|||||| ||||| |||||||||||| ||||||| ||||||||| ||||||||||||| ||||||||||| |||||||| ||||||| ||||||| | |
|
|
| T |
43402926 |
agttcagccagagatggagataagaattgatggacatttggtgattcatgtgaagcatttgcaatggaagtttagaggtaatgaatcagttcatcttagt |
43402827 |
T |
|
| Q |
168 |
aaaatgagagttgaggtatattgggatgttcatgattggttatttagtcctggtttaaaacatgctttgttcatttttaagcc |
250 |
Q |
| |
|
||||||||| |||| || |||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||| |
|
|
| T |
43402826 |
aaaatgagaattgaagtttattgggatgttcatgattggttatttagtcctggtttgaaacatgctttgtttatttttaagcc |
43402744 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 692 times since January 2019
Visitors: 6719