View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0886_low_56 (Length: 250)

Name: NF0886_low_56
Description: NF0886
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0886_low_56
NF0886_low_56
[»] scaffold0192 (1 HSPs)
scaffold0192 (11-250)||(2599-2838)
[»] chr3 (1 HSPs)
chr3 (12-232)||(16919390-16919610)
[»] scaffold0008 (1 HSPs)
scaffold0008 (23-232)||(247684-247893)
[»] chr2 (1 HSPs)
chr2 (33-222)||(22456647-22456836)
[»] chr5 (2 HSPs)
chr5 (23-232)||(42788281-42788490)
chr5 (30-232)||(23468754-23468956)
[»] chr4 (2 HSPs)
chr4 (28-232)||(15239204-15239408)
chr4 (24-232)||(18282076-18282284)
[»] scaffold0034 (1 HSPs)
scaffold0034 (24-232)||(31137-31345)
[»] scaffold0026 (1 HSPs)
scaffold0026 (104-232)||(147374-147502)
[»] chr6 (1 HSPs)
chr6 (126-232)||(23530968-23531074)
[»] scaffold0096 (1 HSPs)
scaffold0096 (24-154)||(26489-26619)


Alignment Details
Target: scaffold0192 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: scaffold0192
Description:

Target: scaffold0192; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 11 - 250
Target Start/End: Original strand, 2599 - 2838
Alignment:
11 cagagaggtaagttcagcggggggtgcgaggtgtatgtccctgtgccgttgacacttgtcacacaggttgacatagtttttcgcatcttttagcatggta 110  Q
    |||||| || ||||||||||||||||||||||| ||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||    
2599 cagagatgtcagttcagcggggggtgcgaggtgcatgtccctgtgtcgttgatacttgtcacacaggttgacatagtttttcgcatcttttagcatggta 2698  T
111 ggccaaaagtatcatgctcgtaggacctttttagcaagagctttggcaccaagatgttgtctacatatgccgtagtggatgtcggcaaggacttcttggg 210  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||    
2699 ggccaaaagtatcatgctcgtaggacctttttagcaagagctttggcacgaagatgttgtctacatatgccgtagtggatctcggcaaggacttcttggg 2798  T
211 tctctttaggtcccatacacttaaagtgaatgagcaggcc 250  Q
    ||||||||||||||||||||||||||||||||||||||||    
2799 tctctttaggtcccatacacttaaagtgaatgagcaggcc 2838  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 97; Significance: 9e-48; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 97; E-Value: 9e-48
Query Start/End: Original strand, 12 - 232
Target Start/End: Original strand, 16919390 - 16919610
Alignment:
12 agagaggtaagttcagcggggggtgcgaggtgtatgtccctgtgccgttgacacttgtcacacaggttgacatagtttttcgcatcttttagcatggtag 111  Q
    ||||| || ||||| || || ||||||||||  ||||| | ||| |||||||  |||||||||||||||||||| | ||| |||| ||| | |||||| |    
16919390 agagatgtcagttcggcaggaggtgcgaggttcatgtctccgtgtcgttgacctttgtcacacaggttgacataatctttggcatatttcaacatggtgg 16919489  T
112 gccaaaagtatcatgctcgtaggacctttttagcaagagctttggcaccaagatgttgtctacatatgccgtagtggatgtcggcaaggacttcttgggt 211  Q
    |||||||||||| |||||||||||||||||| || |||||||| ||||||||||||||||| |||||||| | ||| | ||||||||| |||||||||||    
16919490 gccaaaagtatcctgctcgtaggacctttttggcgagagctttcgcaccaagatgttgtctgcatatgccattgtgtacgtcggcaagtacttcttgggt 16919589  T
212 ctctttaggtcccatacactt 232  Q
    ||| |||||||||| ||||||    
16919590 ctcgttaggtcccaaacactt 16919610  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0008 (Bit Score: 86; Significance: 3e-41; HSPs: 1)
Name: scaffold0008
Description:

Target: scaffold0008; HSP #1
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 23 - 232
Target Start/End: Original strand, 247684 - 247893
Alignment:
23 ttcagcggggggtgcgaggtgtatgtccctgtgccgttgacacttgtcacacaggttgacatagtttttcgcatcttttagcatggtaggccaaaagtat 122  Q
    ||||||||||||||||||||| ||||||| ||| || | ||| ||||||||  |||| || |||  ||  |||||||| | |||||||||||||||||||    
247684 ttcagcggggggtgcgaggtgcatgtccccgtgtcgctaacatttgtcacaatggtttacgtagacttaggcatctttcaacatggtaggccaaaagtat 247783  T
123 catgctcgtaggacctttttagcaagagctttggcaccaagatgttgtctacatatgccgtagtggatgtcggcaaggacttcttgggtctctttaggtc 222  Q
    | |||||||||||||||||| || |||||||| ||||||||||||||||  || ||||||   |||| ||| || ||||||||||||||||| |||||||    
247784 cctgctcgtaggacctttttcgcgagagctttagcaccaagatgttgtccgcagatgccgccatggacgtcagcgaggacttcttgggtctcgttaggtc 247883  T
223 ccatacactt 232  Q
    ||| ||||||    
247884 ccaaacactt 247893  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 74; Significance: 5e-34; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 33 - 222
Target Start/End: Complemental strand, 22456836 - 22456647
Alignment:
33 ggtgcgaggtgtatgtccctgtgccgttgacacttgtcacacaggttgacatagtttttcgcatcttttagcatggtaggccaaaagtatcatgctcgta 132  Q
    ||||||| ||| |||||||  || |||||||| ||||||||||||||||| || |  || || |||||||||||||| |||||||| |||| ||| ||||    
22456836 ggtgcgatgtgcatgtccccatgtcgttgacatttgtcacacaggttgacgtaatccttggcgtcttttagcatggtgggccaaaattatcctgcacgta 22456737  T
133 ggacctttttagcaagagctttggcaccaagatgttgtctacatatgccgtagtggatgtcggcaaggacttcttgggtctctttaggtc 222  Q
    |||||||||| || ||| |||| ||||||||||||||||  |||||||| | ||| || |||| |||||||||||| ||||| |||||||    
22456736 ggacctttttggcgagaacttttgcaccaagatgttgtccgcatatgccatcgtgtatttcgggaaggacttcttgagtctcgttaggtc 22456647  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 66; Significance: 3e-29; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 23 - 232
Target Start/End: Original strand, 42788281 - 42788490
Alignment:
23 ttcagcggggggtgcgaggtgtatgtccctgtgccgttgacacttgtcacacaggttgacatagtttttcgcatcttttagcatggtaggccaaaagtat 122  Q
    |||||| |||||||| ||||| ||||||| ||| || || || |||||||| ||||| || |||| ||  |||||||| ||||| |||||||| ||||||    
42788281 ttcagcagggggtgcaaggtgcatgtccccgtgtcgctggcatttgtcacataggttcacgtagtcttgggcatctttcagcattgtaggccagaagtat 42788380  T
123 catgctcgtaggacctttttagcaagagctttggcaccaagatgttgtctacatatgccgtagtggatgtcggcaaggacttcttgggtctctttaggtc 222  Q
    |  || || | ||||||||| || |||||||| |  |||||||| ||||  || ||||||| ||||| ||| |||||||||||||||||||| |||||||    
42788381 cccgcccgcatgacctttttcgcgagagcttttgttccaagatgctgtccgcagatgccgtcgtggacgtcagcaaggacttcttgggtctcgttaggtc 42788480  T
223 ccatacactt 232  Q
    ||| ||||||    
42788481 ccagacactt 42788490  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 30 - 232
Target Start/End: Original strand, 23468754 - 23468956
Alignment:
30 gggggtgcgaggtgtatgtccctgtgccgttgacacttgtcacacaggttgacatagtttttcgcatcttttagcatggtaggccaaaagtatcatgctc 129  Q
    |||||||| ||||| | ||||| ||| || || || |||||||| ||||| || |||| ||  || || || | |||||||| |||| ||||||  ||||    
23468754 gggggtgctaggtgcacgtccccgtgtcgctggcaattgtcacaaaggttcacgtagtcttgggcgtccttcaacatggtagaccaatagtatccggctc 23468853  T
130 gtaggacctttttagcaagagctttggcaccaagatgttgtctacatatgccgtagtggatgtcggcaaggacttcttgggtctctttaggtcccataca 229  Q
    |||||| ||||||||| |||||| | || | ||| |||| ||  || || |||| ||| | |||||| ||||||||||||||||| ||| |||| | |||    
23468854 gtaggatctttttagcgagagctcttgcgcaaagttgttttccgcagataccgtcgtgaacgtcggcgaggacttcttgggtctcgttacgtcctaaaca 23468953  T
230 ctt 232  Q
    |||    
23468954 ctt 23468956  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 65; Significance: 1e-28; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 28 - 232
Target Start/End: Original strand, 15239204 - 15239408
Alignment:
28 cggggggtgcgaggtgtatgtccctgtgccgttgacacttgtcacacaggttgacatagtttttcgcatcttttagcatggtaggccaaaagtatcatgc 127  Q
    |||||||||||||||| ||||||| ||| || || || ||||| || ||||| ||||||| ||  ||||| || | ||| ||||||||| |||||| |||    
15239204 cggggggtgcgaggtgcatgtccccgtgtcgctggcatttgtcgcaaaggtttacatagtcttcggcatccttcaacatagtaggccaatagtatcctgc 15239303  T
128 tcgtaggacctttttagcaagagctttggcaccaagatgttgtctacatatgccgtagtggatgtcggcaaggacttcttgggtctctttaggtcccata 227  Q
    ||||||||||||| | || |||| |||  || ||||||||||||  || |||||||  |||| ||| || ||||||||||||||||| |||||||||| |    
15239304 tcgtaggacctttcttgcgagagattttacatcaagatgttgtccgcagatgccgtcatggacgtcagcgaggacttcttgggtctcgttaggtcccaga 15239403  T
228 cactt 232  Q
    |||||    
15239404 cactt 15239408  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 24 - 232
Target Start/End: Complemental strand, 18282284 - 18282076
Alignment:
24 tcagcggggggtgcgaggtgtatgtccctgtgccgttgacacttgtcacacaggttgacatagtttttcgcatcttttagcatggtaggccaaaagtatc 123  Q
    |||||||||||||| ||||| ||||||| ||| || || || |||||||| ||||| |  |||| ||  |  || || | ||| ||||||||  ||||||    
18282284 tcagcggggggtgctaggtgcatgtccccgtgtcgctggcatttgtcacaaaggttcatgtagtcttgggtgtccttcaacattgtaggccagtagtatc 18282185  T
124 atgctcgtaggacctttttagcaagagctttggcaccaagatgttgtctacatatgccgtagtggatgtcggcaaggacttcttgggtctctttaggtcc 223  Q
      |||||||||| || |||||| |||||||| |||||||| |||||||  || ||||| | ||| | |||||| ||||||||||||||||| ||| ||||    
18282184 cggctcgtaggatctgtttagcgagagcttttgcaccaaggtgttgtccgcagatgccatcgtgaacgtcggcgaggacttcttgggtctcgttaagtcc 18282085  T
224 catacactt 232  Q
     | ||||||    
18282084 taaacactt 18282076  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0034 (Bit Score: 61; Significance: 3e-26; HSPs: 1)
Name: scaffold0034
Description:

Target: scaffold0034; HSP #1
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 24 - 232
Target Start/End: Complemental strand, 31345 - 31137
Alignment:
24 tcagcggggggtgcgaggtgtatgtccctgtgccgttgacacttgtcacacaggttgacatagtttttcgcatcttttagcatggtaggccaaaagtatc 123  Q
    |||||||||||||| ||||| |||| || ||| ||  | || ||||| || ||||| || |||| ||  || ||||| ||||||||||||||| |||| |    
31345 tcagcggggggtgcaaggtgcatgtgcccgtgtcgccggcatttgtcgcaaaggtttacgtagtcttgggcgtctttcagcatggtaggccaatagtacc 31246  T
124 atgctcgtaggacctttttagcaagagctttggcaccaagatgttgtctacatatgccgtagtggatgtcggcaaggacttcttgggtctctttaggtcc 223  Q
      ||||||| ||||||||| || |||||||| ||||||||||||||||  || |||||||  |||| |||||| |||||||||||||| || ||||||||    
31245 ccgctcgtaagacctttttcgcgagagcttttgcaccaagatgttgtccgcagatgccgtcatggacgtcggcgaggacttcttgggtatcgttaggtcc 31146  T
224 catacactt 232  Q
     | ||||||    
31145 tagacactt 31137  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0026 (Bit Score: 57; Significance: 7e-24; HSPs: 1)
Name: scaffold0026
Description:

Target: scaffold0026; HSP #1
Raw Score: 57; E-Value: 7e-24
Query Start/End: Original strand, 104 - 232
Target Start/End: Complemental strand, 147502 - 147374
Alignment:
104 catggtaggccaaaagtatcatgctcgtaggacctttttagcaagagctttggcaccaagatgttgtctacatatgccgtagtggatgtcggcaaggact 203  Q
    ||||||||||||| |||||| |  |||||| |||||||| || |||||||||| |||||||||||||| ||| |||||||  |||| ||| || ||||||    
147502 catggtaggccaatagtatcctcttcgtagtacctttttcgcgagagctttggaaccaagatgttgtccacagatgccgtcatggacgtcagcgaggact 147403  T
204 tcttgggtctctttaggtcccatacactt 232  Q
    ||||||||||| ||||||| || ||||||    
147402 tcttgggtctccttaggtcgcagacactt 147374  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 43; Significance: 0.000000000000001; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 126 - 232
Target Start/End: Original strand, 23530968 - 23531074
Alignment:
126 gctcgtaggacctttttagcaagagctttggcaccaagatgttgtctacatatgccgtagtggatgtcggcaaggacttcttgggtctctttaggtccca 225  Q
    ||||||||||||||||| ||||||||||| |||| |||||||||||  || |||||||  ||||  || || ||||||||||||||||| ||| || |||    
23530968 gctcgtaggacctttttcgcaagagctttagcactaagatgttgtccgcagatgccgtcatggacatcagcgaggacttcttgggtctcgttaagtacca 23531067  T
226 tacactt 232  Q
     ||||||    
23531068 gacactt 23531074  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0096 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 1)
Name: scaffold0096
Description:

Target: scaffold0096; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 24 - 154
Target Start/End: Complemental strand, 26619 - 26489
Alignment:
24 tcagcggggggtgcgaggtgtatgtccctgtgccgttgacacttgtcacacaggttgacatagtttttcgcatcttttagcatggtaggccaaaagtatc 123  Q
    ||||||||||||||  |||| ||||||| ||| || || || |||||||| ||||| || |||| ||  || || || | ||||||||||||| ||||||    
26619 tcagcggggggtgcttggtgcatgtccccgtgtcgctggcatttgtcacaaaggtttacgtagtcttgggcgtccttcaacatggtaggccaatagtatc 26520  T
124 atgctcgtaggacctttttagcaagagcttt 154  Q
      |||||||||| ||||||||| ||||||||    
26519 cggctcgtaggatctttttagcgagagcttt 26489  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 969 times since January 2019
Visitors: 6719