View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0886_low_58 (Length: 247)

Name: NF0886_low_58
Description: NF0886
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0886_low_58
NF0886_low_58
[»] scaffold0192 (1 HSPs)
scaffold0192 (21-247)||(3161-3382)
[»] chr3 (1 HSPs)
chr3 (21-238)||(16920005-16920221)
[»] chr2 (1 HSPs)
chr2 (79-247)||(22456093-22456261)
[»] scaffold0002 (1 HSPs)
scaffold0002 (85-151)||(384325-384391)
[»] scaffold0034 (1 HSPs)
scaffold0034 (94-146)||(30596-30648)


Alignment Details
Target: scaffold0192 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: scaffold0192
Description:

Target: scaffold0192; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 21 - 247
Target Start/End: Complemental strand, 3382 - 3161
Alignment:
21 atcatcaaattctaaaggaagtggagcaggggtagttgtagaaaacagagaaggtagtgtcgttgaaatctcccttggtttgtctttccctgtaactaac 120  Q
    |||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||    
3382 atcatccaattctaaaggaagtggagcaggggtaattgtagaaaacagagaaggtagtgtcgttgaaatctcccttggtttgtctttccctataactaac 3283  T
121 aacattgcagagtacgaagccttcttagccggcctgcagatcgctctggatctaggagcccgaaaggtaaaaatcttcgttgtttcccaagtagtggctt 220  Q
    |||| ||||||||||||||||||||||||||||||||||     ||||||||||||||||||||||||||||||||| |||||||||||| |||||||||    
3282 aacactgcagagtacgaagccttcttagccggcctgcag-----tctggatctaggagcccgaaaggtaaaaatctttgttgtttcccaattagtggctt 3188  T
221 cgtaagtgactggcgattaccaggtcc 247  Q
    |||||||||||||||||||||||||||    
3187 cgtaagtgactggcgattaccaggtcc 3161  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 90; Significance: 1e-43; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 21 - 238
Target Start/End: Complemental strand, 16920221 - 16920005
Alignment:
21 atcatcaaattctaaaggaagtggagcaggggtagttgtagaaaacagagaaggtagtgtcgttgaaatctcccttggtttgtctttccctgtaactaac 120  Q
    |||||| |||||||||||||| |||||||||||| |||||||||| |  ||||||| |||||||||| | ||||||  ||| ||||| ||||||||||||    
16920221 atcatccaattctaaaggaagcggagcaggggtaattgtagaaaaaaatgaaggtattgtcgttgaatt-tcccttattttatcttttcctgtaactaac 16920123  T
121 aacattgcagagtacgaagccttcttagccggcctgcagatcgctctggatctaggagcccgaaaggtaaaaatcttcgttgtttcccaagtagtggctt 220  Q
    |||| ||||||||||||||||||||| |||||||||| |||||| | |||||||||| ||  |||||||||||||||    | ||| ||| |||||||||    
16920122 aacactgcagagtacgaagccttcttggccggcctgcggatcgcccaggatctaggaaccaaaaaggtaaaaatctttaccgattctcaattagtggctt 16920023  T
221 cgtaagtgactggcgatt 238  Q
    || | |||||| ||||||    
16920022 cgcaggtgactcgcgatt 16920005  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 65; Significance: 1e-28; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 79 - 247
Target Start/End: Original strand, 22456093 - 22456261
Alignment:
79 gtcgttgaaatctcccttggtttgtctttccctgtaactaacaacattgcagagtacgaagccttcttagccggcctgcagatcgctctggatctaggag 178  Q
    |||||||||||||||||||| || ||||| ||||| |||||||||| || ||| || || ||||||||||||||||||| |||||| | |||| ||||||    
22456093 gtcgttgaaatctcccttggcttatcttttcctgtgactaacaacactgtagaatatgaggccttcttagccggcctgcggatcgcccaggatttaggag 22456192  T
179 cccgaaaggtaaaaatcttcgttgtttcccaagtagtggcttcgtaagtgactggcgattaccaggtcc 247  Q
    || ||||||||||| ||||    | ||| ||| ||||||||||  |||| |||||||| ||||||||||    
22456193 ccagaaaggtaaaattctttaccgattcacaattagtggcttcccaagttactggcgaataccaggtcc 22456261  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0002 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: scaffold0002
Description:

Target: scaffold0002; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 85 - 151
Target Start/End: Complemental strand, 384391 - 384325
Alignment:
85 gaaatctcccttggtttgtctttccctgtaactaacaacattgcagagtacgaagccttcttagccg 151  Q
    ||||| || |||| ||| |||||||||||||| || |||| ||||| ||||||||||||||| ||||    
384391 gaaatttctcttgctttatctttccctgtaaccaataacactgcagggtacgaagccttcttggccg 384325  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0034 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: scaffold0034
Description:

Target: scaffold0034; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 94 - 146
Target Start/End: Original strand, 30596 - 30648
Alignment:
94 cttggtttgtctttccctgtaactaacaacattgcagagtacgaagccttctt 146  Q
    |||| ||| |||||||| ||||| || |||| |||||||||||||||||||||    
30596 cttgctttatctttccccgtaaccaataacactgcagagtacgaagccttctt 30648  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 706 times since January 2019
Visitors: 6719