View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0886_low_59 (Length: 244)
Name: NF0886_low_59
Description: NF0886
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0886_low_59 |
 |  |
|
[»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 221; Significance: 1e-122; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 20 - 244
Target Start/End: Original strand, 48919743 - 48919967
Alignment:
Q |
20 |
acaaccttggtcccatagttaccagactgaggaaaatgaattatgttcttcaagcatgaggaaccacatcaatatcatgctgctgcacggatgaatgcag |
119 |
Q |
|
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
48919743 |
acaaccttggtcccatagttagcagactgaggaaaatgaattatgttcttcaagcatgaggaaccacatcaatatcatgctgctgcacggatgaatgcag |
48919842 |
T |
 |
Q |
120 |
ttttcattgtcaaagaggatcatttcctgtccaagttggagtttgcaacggtttttgtcatgccacgctcaaaggatcaagagaagattgaaccttatgg |
219 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
48919843 |
ttttcattgtcaaagaggatcatttcctgtccaagttggagtttgcaacggtttttgtcatgccacgctcaaaggatcaagagaagattgaaccttatgg |
48919942 |
T |
 |
Q |
220 |
ttacttaacttgactttgctcctca |
244 |
Q |
|
|
||||||||||||||||||||||||| |
|
|
T |
48919943 |
ttacttaacttgactttgctcctca |
48919967 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
© Oklahoma State University