View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0886_low_59 (Length: 244)
Name: NF0886_low_59
Description: NF0886
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0886_low_59 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 221; Significance: 1e-122; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 20 - 244
Target Start/End: Original strand, 48919743 - 48919967
Alignment:
| Q |
20 |
acaaccttggtcccatagttaccagactgaggaaaatgaattatgttcttcaagcatgaggaaccacatcaatatcatgctgctgcacggatgaatgcag |
119 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48919743 |
acaaccttggtcccatagttagcagactgaggaaaatgaattatgttcttcaagcatgaggaaccacatcaatatcatgctgctgcacggatgaatgcag |
48919842 |
T |
|
| Q |
120 |
ttttcattgtcaaagaggatcatttcctgtccaagttggagtttgcaacggtttttgtcatgccacgctcaaaggatcaagagaagattgaaccttatgg |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48919843 |
ttttcattgtcaaagaggatcatttcctgtccaagttggagtttgcaacggtttttgtcatgccacgctcaaaggatcaagagaagattgaaccttatgg |
48919942 |
T |
|
| Q |
220 |
ttacttaacttgactttgctcctca |
244 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
48919943 |
ttacttaacttgactttgctcctca |
48919967 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University