View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0886_low_59 (Length: 244)

Name: NF0886_low_59
Description: NF0886
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0886_low_59
NF0886_low_59
[»] chr7 (1 HSPs)
chr7 (20-244)||(48919743-48919967)


Alignment Details
Target: chr7 (Bit Score: 221; Significance: 1e-122; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 20 - 244
Target Start/End: Original strand, 48919743 - 48919967
Alignment:
20 acaaccttggtcccatagttaccagactgaggaaaatgaattatgttcttcaagcatgaggaaccacatcaatatcatgctgctgcacggatgaatgcag 119  Q
    ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
48919743 acaaccttggtcccatagttagcagactgaggaaaatgaattatgttcttcaagcatgaggaaccacatcaatatcatgctgctgcacggatgaatgcag 48919842  T
120 ttttcattgtcaaagaggatcatttcctgtccaagttggagtttgcaacggtttttgtcatgccacgctcaaaggatcaagagaagattgaaccttatgg 219  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
48919843 ttttcattgtcaaagaggatcatttcctgtccaagttggagtttgcaacggtttttgtcatgccacgctcaaaggatcaagagaagattgaaccttatgg 48919942  T
220 ttacttaacttgactttgctcctca 244  Q
    |||||||||||||||||||||||||    
48919943 ttacttaacttgactttgctcctca 48919967  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University