View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0886_low_64 (Length: 213)
Name: NF0886_low_64
Description: NF0886
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0886_low_64 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 148; Significance: 3e-78; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 1 - 160
Target Start/End: Original strand, 40290233 - 40290392
Alignment:
Q |
1 |
cagaacataattcataagtggtatgatctcttcgtaatggtaagcagtttagacatgggtcgtactatctcatccttacggcagacagtttctacatgaa |
100 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
T |
40290233 |
cagaacataattcataagtggtatgatctcttcgtaatggtaaacagtttagacatgggtcgtactatcttatccttacggcagacagtttctacatgaa |
40290332 |
T |
 |
Q |
101 |
ttgtaatatctctttgttgcatcaaacgaaacacctatagaaattctatattcgctttcc |
160 |
Q |
|
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
T |
40290333 |
ttgtaatatctctttgttgcatcaaacaaaacacctatagaaattctatattcgctttcc |
40290392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University