View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0888_low_15 (Length: 252)
Name: NF0888_low_15
Description: NF0888
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0888_low_15 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 1 - 243
Target Start/End: Complemental strand, 29789573 - 29789331
Alignment:
Q |
1 |
ttatcattactccttttaagggatctgctttaaaagtatctcttttcttatgacactatctaattagtaaattgttcatatttgaaaagagctagacaaa |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
29789573 |
ttatcattactccttttaagggatctgctttaaaagtatctcttttcttatgacactatctaattagtaaattgttcatatttgaaaagagctagacaaa |
29789474 |
T |
 |
Q |
101 |
atgtcacaagttcccctgctattaagtcaagtaactcactttgtcaatgtattccnnnnnnnngatattatttcattaattttctttattctatatatca |
200 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
T |
29789473 |
atgtcacaagttcccctgctattaagtcaagtaactcactttgtcaatgtattccaaaaaaaagatattatttcattaattttctttattctatatatca |
29789374 |
T |
 |
Q |
201 |
tcacttactcaacatttatgttatcttttcttaccagtattat |
243 |
Q |
|
|
|||||||||||||||||||||||||||||||||||| |||||| |
|
|
T |
29789373 |
tcacttactcaacatttatgttatcttttcttaccaatattat |
29789331 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University