View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0888_low_18 (Length: 228)
Name: NF0888_low_18
Description: NF0888
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0888_low_18 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 153; Significance: 3e-81; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 1 - 161
Target Start/End: Original strand, 14925715 - 14925875
Alignment:
| Q |
1 |
tcatcactcatcgtcatcaaattttcaaggtgggtttggttcattttttatctacaataatttactacaataatatttcattattttatgttgcatgatg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
14925715 |
tcatcactcatcgtcatcaaattttcaaggtgggtttggttcattttttatctacaattatttactacaataatattttattattttatgttgcatgatg |
14925814 |
T |
|
| Q |
101 |
agtaaatgaaaaccatcatgttcatggtgaattttagttcaacttagtataacaggttgaa |
161 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14925815 |
agtaaatgaaaaccatcatgttcatggtgaattttagttcaacttagtataacaggttgaa |
14925875 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 985 times since January 2019
Visitors: 6719