View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0888_low_20 (Length: 214)
Name: NF0888_low_20
Description: NF0888
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0888_low_20 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 113; Significance: 2e-57; HSPs: 12)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 1 - 113
Target Start/End: Complemental strand, 22900377 - 22900265
Alignment:
| Q |
1 |
caagtgaatttctagagccttaaagtcaaatgaaatatcaccatatcacctgccaatagagacatgccctatgactgatttgcttactttaatgtgtcta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22900377 |
caagtgaatttctagagccttaaagtcaaatgaaatatcaccatatcacctgccaatagagacatgccctatgactgatttgcttactttaatgtgtcta |
22900278 |
T |
 |
| Q |
101 |
gtttgctaagtat |
113 |
Q |
| |
|
||||||||||||| |
|
|
| T |
22900277 |
gtttgctaagtat |
22900265 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 109; E-Value: 5e-55
Query Start/End: Original strand, 1 - 113
Target Start/End: Complemental strand, 22882442 - 22882330
Alignment:
| Q |
1 |
caagtgaatttctagagccttaaagtcaaatgaaatatcaccatatcacctgccaatagagacatgccctatgactgatttgcttactttaatgtgtcta |
100 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22882442 |
caagtgaatttttagagccttaaagtcaaatgaaatatcaccatatcacctgccaatagagacatgccctatgactgatttgcttactttaatgtgtcta |
22882343 |
T |
 |
| Q |
101 |
gtttgctaagtat |
113 |
Q |
| |
|
||||||||||||| |
|
|
| T |
22882342 |
gtttgctaagtat |
22882330 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 1 - 113
Target Start/End: Complemental strand, 22915362 - 22915258
Alignment:
| Q |
1 |
caagtgaatttctagagccttaaagtcaaatgaaatatcaccatatcacctgccaatagagacatgccctatgactgatttgcttactttaatgtgtcta |
100 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22915362 |
caagtgaatttctagagcctctaagtcaaatgaaatatcacc--------tgccaatagagacatgccctatgactgatttgcttactttaatgtgtcta |
22915271 |
T |
 |
| Q |
101 |
gtttgctaagtat |
113 |
Q |
| |
|
||||||||||||| |
|
|
| T |
22915270 |
gtttgctaagtat |
22915258 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 1 - 88
Target Start/End: Complemental strand, 22869619 - 22869532
Alignment:
| Q |
1 |
caagtgaatttctagagccttaaagtcaaatgaaatatcaccatatcacctgccaatagagacatgccctatgactgatttgcttact |
88 |
Q |
| |
|
||||||||||||| ||||| || |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
22869619 |
caagtgaatttctgaagcctctaattcaaatgaaatatcaccatatcacctaccaatagagacatgccctatgactgatttgcttact |
22869532 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 1 - 88
Target Start/End: Original strand, 22984423 - 22984510
Alignment:
| Q |
1 |
caagtgaatttctagagccttaaagtcaaatgaaatatcaccatatcacctgccaatagagacatgccctatgactgatttgcttact |
88 |
Q |
| |
|
||||||||||||||||||| | ||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
22984423 |
caagtgaatttctagagccgccatgtcaaatgaaatatcaccatatcacttgccaatagagacatgccctatgattgatttgcttact |
22984510 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 1 - 88
Target Start/End: Complemental strand, 23803995 - 23803908
Alignment:
| Q |
1 |
caagtgaatttctagagccttaaagtcaaatgaaatatcaccatatcacctgccaatagagacatgccctatgactgatttgcttact |
88 |
Q |
| |
|
||||||||||||||||||| | ||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
23803995 |
caagtgaatttctagagccgccatgtcaaatgaaatatcaccatatcacttgccaatagagacatgccctatgattgatttgcttact |
23803908 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 35 - 88
Target Start/End: Complemental strand, 18127461 - 18127408
Alignment:
| Q |
35 |
atatcaccatatcacctgccaatagagacatgccctatgactgatttgcttact |
88 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18127461 |
atatcactatatcacctgccaatagagacatgccctatgactgatttgcttact |
18127408 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 35 - 88
Target Start/End: Complemental strand, 22855771 - 22855718
Alignment:
| Q |
35 |
atatcaccatatcacctgccaatagagacatgccctatgactgatttgcttact |
88 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22855771 |
atatcactatatcacctgccaatagagacatgccctatgactgatttgcttact |
22855718 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #9
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 1 - 86
Target Start/End: Original strand, 22966163 - 22966250
Alignment:
| Q |
1 |
caagtgaatttctagagccttaaagtcaaatgaaatatcaccatat--cacctgccaatagagacatgccctatgactgatttgctta |
86 |
Q |
| |
|
||||||||||||| |||||| |||| ||||||||||||||||||| || |||||||||||||||||||||||| ||||||||||| |
|
|
| T |
22966163 |
caagtgaatttctggagcctccaagtgaaatgaaatatcaccatatatcatgtgccaatagagacatgccctatgattgatttgctta |
22966250 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #10
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 1 - 86
Target Start/End: Complemental strand, 23822230 - 23822143
Alignment:
| Q |
1 |
caagtgaatttctagagccttaaagtcaaatgaaatatcaccatat--cacctgccaatagagacatgccctatgactgatttgctta |
86 |
Q |
| |
|
||||||||||||| |||||| |||| ||||||||||||||||||| || |||||||||||||||||||||||| ||||||||||| |
|
|
| T |
23822230 |
caagtgaatttctggagcctccaagtgaaatgaaatatcaccatatatcatgtgccaatagagacatgccctatgattgatttgctta |
23822143 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #11
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 4 - 87
Target Start/End: Original strand, 22960627 - 22960710
Alignment:
| Q |
4 |
gtgaatttctagagccttaaagtcaaatgaaatatcaccatatcacctgccaatagagacatgccctatgactgatttgcttac |
87 |
Q |
| |
|
|||||||| |||||| | || |||||||||||||||||||||||||||||||||||| |||||||| || |||||||||||| |
|
|
| T |
22960627 |
gtgaatttatagagcttctaactcaaatgaaatatcaccatatcacctgccaatagagtgatgccctacgattgatttgcttac |
22960710 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #12
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 4 - 87
Target Start/End: Complemental strand, 23827765 - 23827682
Alignment:
| Q |
4 |
gtgaatttctagagccttaaagtcaaatgaaatatcaccatatcacctgccaatagagacatgccctatgactgatttgcttac |
87 |
Q |
| |
|
|||||||| |||||| | || |||||||||||||||||||||||||||||||||||| |||||||| || |||||||||||| |
|
|
| T |
23827765 |
gtgaatttatagagcttctaactcaaatgaaatatcaccatatcacctgccaatagagtgatgccctacgattgatttgcttac |
23827682 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University