View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0889_high_12 (Length: 207)

Name: NF0889_high_12
Description: NF0889
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0889_high_12
NF0889_high_12
[»] chr2 (1 HSPs)
chr2 (1-158)||(6775299-6775456)


Alignment Details
Target: chr2 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 1 - 158
Target Start/End: Complemental strand, 6775456 - 6775299
Alignment:
1 aaaacagatccttctccatcttcaatctctcctttccaaaatctgtcaccagaaattgctccacttttgccttctcctggtggtgctttaccaactccta 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||    
6775456 aaaacagatccttctccatcttcaatctctcctttccaaaatctgtcaccagaaattgctccacttttgccttctcctggtggtgctttgccaactccta 6775357  T
101 caggctctgacattcccaccattccttccaacccaagccctccaaaccctgatgatgt 158  Q
    ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||    
6775356 caggctctgacattcccactattccttccaacccaagccctccaaaccctgatgatgt 6775299  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 74 times since January 2019
Visitors: 6713