View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0889_low_10 (Length: 388)
Name: NF0889_low_10
Description: NF0889
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0889_low_10 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 315; Significance: 1e-177; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 315; E-Value: 1e-177
Query Start/End: Original strand, 22 - 372
Target Start/End: Complemental strand, 22278470 - 22278120
Alignment:
| Q |
22 |
catcatctcttcatgtttatgctatttacttcttcaaagcctcttcaggtatcatttccgctatcaattctattttatgttgtcttttttggggtggggg |
121 |
Q |
| |
|
|||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
22278470 |
catcatcttttcatgtttatgctatctacttcttcaaagcctcttcaggtatcatttcctctatcgattctattttatgttgtcttttttggggtggggg |
22278371 |
T |
|
| Q |
122 |
tgaggaatataggtaaactttctgggtttattcagattatgtttgtttgagtaaggaggaaggaggtatgggggtgaggtggttaagtgagtttaatgtt |
221 |
Q |
| |
|
||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22278370 |
tgaggaatataggtaaattttctaggtttattcagattatgtttgtttgagtaaggaggaaggaggtatgggggtgaggtggttaagtgagtttaatgtt |
22278271 |
T |
|
| Q |
222 |
gcactgttgggaaaatgatgttggtggatcagggtgattgttgtattgtacgtctgtggcgaggtacgaagtataaagtgggtgggtgaaggaggggagt |
321 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
22278270 |
gcactgttgggaaaatgatgttggtggatcagggggattgttgtattgtacgtctgtggcgaggtacgaagtataaagtgggtgggtgaaggaggggggt |
22278171 |
T |
|
| Q |
322 |
ctgggagggtcgagttggtggaaagatatcgtgaggattcgtgatgatgtc |
372 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
22278170 |
ctgggagggtcgagttggtggaaggatatcgtgaggattcgtgatgatgtc |
22278120 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 174 - 250
Target Start/End: Complemental strand, 7287375 - 7287299
Alignment:
| Q |
174 |
aaggaggaaggaggtatgggggtgaggtggttaagtgagtttaatgttgcactgttgggaaaatgatgttggtggat |
250 |
Q |
| |
|
||||||||||||||| |||||||| || ||||| |||| |||||| || || | || |||||||| |||||| |||| |
|
|
| T |
7287375 |
aaggaggaaggaggtttgggggtgcggcggttatgtgaatttaatatttcattattaggaaaatggtgttggcggat |
7287299 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 174 - 250
Target Start/End: Complemental strand, 7288043 - 7287967
Alignment:
| Q |
174 |
aaggaggaaggaggtatgggggtgaggtggttaagtgagtttaatgttgcactgttgggaaaatgatgttggtggat |
250 |
Q |
| |
|
||||||||||||||| |||||||| || ||||| |||| |||||| || || | || |||||||| |||||| |||| |
|
|
| T |
7288043 |
aaggaggaaggaggtttgggggtgcggcggttatgtgaatttaatatttcattattaggaaaatggtgttggcggat |
7287967 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 27 - 85
Target Start/End: Original strand, 21089887 - 21089945
Alignment:
| Q |
27 |
tctcttcatgtttatgctatttacttcttcaaagcctcttcaggtatcatttccgctat |
85 |
Q |
| |
|
||||||| | |||||||||||| |||||||||| | ||||||||||||||||| |||| |
|
|
| T |
21089887 |
tctcttcctatttatgctatttccttcttcaaattcccttcaggtatcatttcctctat |
21089945 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 30; Significance: 0.0000001; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 33 - 98
Target Start/End: Complemental strand, 17829525 - 17829460
Alignment:
| Q |
33 |
catgtttatgctatttacttcttcaaagcctcttcaggtatcatttccgctatcaattctatttta |
98 |
Q |
| |
|
|||| ||||||||||| |||||||||||| | ||||||||||| ||| ||||| ||||| ||||| |
|
|
| T |
17829525 |
catgattatgctattttcttcttcaaagctccctcaggtatcatctcctctatcgattctttttta |
17829460 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 27 - 79
Target Start/End: Complemental strand, 380758 - 380706
Alignment:
| Q |
27 |
tctcttcatgtttatgctatttacttcttcaaagcctcttcaggtatcatttc |
79 |
Q |
| |
|
||||| ||||| |||||| ||| |||||||||||| || |||||||||||||| |
|
|
| T |
380758 |
tctctgcatgtctatgctctttccttcttcaaagcttcatcaggtatcatttc |
380706 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 30; Significance: 0.0000001; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 50 - 119
Target Start/End: Original strand, 41352565 - 41352634
Alignment:
| Q |
50 |
cttcttcaaagcctcttcaggtatcatttccgctatcaattctattttatgttgtcttttttggggtggg |
119 |
Q |
| |
|
||||||||||||| | |||| |||||||||| |||| |||||||||||||| || | |||| ||||||| |
|
|
| T |
41352565 |
cttcttcaaagccccgtcagatatcatttcctctattgattctattttatgtcgtttcttttagggtggg |
41352634 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 178 - 247
Target Start/End: Original strand, 51072127 - 51072196
Alignment:
| Q |
178 |
aggaaggaggtatgggggtgaggtggttaagtgagtttaatgttgcactgttgggaaaatgatgttggtg |
247 |
Q |
| |
|
||||||||||| ||||||| ||| || | || |||||||||||||| ||||| || ||||| |||||||| |
|
|
| T |
51072127 |
aggaaggaggtttgggggtcaggaggatgagggagtttaatgttgctctgttagggaaatggtgttggtg |
51072196 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 591 times since January 2019
Visitors: 6705