View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0889_low_11 (Length: 386)
Name: NF0889_low_11
Description: NF0889
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0889_low_11 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 282; Significance: 1e-158; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 282; E-Value: 1e-158
Query Start/End: Original strand, 7 - 304
Target Start/End: Complemental strand, 2452207 - 2451910
Alignment:
Q |
7 |
gtgagatgaaggttccaaagaagagtagttctaaggtggagttatgagggtagaaagtccatgctatagaggcttgttgggtgggaagattcatacattt |
106 |
Q |
|
|
|||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
2452207 |
gtgaaatgaaggttccaaagaagactagttctaaggtggagttatgagggtagaaagtccatgctatagaggcttgttgggtgggaagattcatacattt |
2452108 |
T |
 |
Q |
107 |
ttggaaggttttagtagaggtttctacagtgcagtgagatgaaaaaccaatgtgaggaaggaaacacatttggagaaggaagacataaacaagaaacatg |
206 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
2452107 |
ttggaaggttttagtagaggtttctacagtgcagtgagatgaaaaaccaatgtgaggaaggaaacacatttggagaaggaagacataaacaagaaacatg |
2452008 |
T |
 |
Q |
207 |
atggtgcagtggtagatggagaattgcactagtggatggtttatttggtttgtaaagctttatctttatgcaaaagatttgtattttgtgatgatgtc |
304 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||| |
|
|
T |
2452007 |
atggtgcagtggtagatggagaattgcactagtggatggtttatttggtttgtaaagctttatctttatgcaaacgatttgtattttgtaatgatgtc |
2451910 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 86; Significance: 5e-41; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 86; E-Value: 5e-41
Query Start/End: Original strand, 7 - 172
Target Start/End: Original strand, 42769324 - 42769489
Alignment:
Q |
7 |
gtgagatgaaggttccaaagaagagtagttctaaggtggagttatgagggtagaaagtccatgctatagaggcttgttgggtgggaagattcatacattt |
106 |
Q |
|
|
|||| ||||| || |||||||| | |||||||||||||||| ||||||||| |||||||||||||| ||||||||||| || ||||||||||| ||||| |
|
|
T |
42769324 |
gtgaaatgaaagtgccaaagaaaattagttctaaggtggagctatgagggtgtaaagtccatgctattgaggcttgttgtgtaggaagattcatgcattt |
42769423 |
T |
 |
Q |
107 |
ttggaaggttttagtagaggtttctacagtgcagtgagatgaaaaaccaatgtgaggaaggaaaca |
172 |
Q |
|
|
||| ||||||||||| || |||||| |||||||||||||| ||| ||||||||||||||||||| |
|
|
T |
42769424 |
ttgaaaggttttagtggaagtttctgttgtgcagtgagatgagaaaacaatgtgaggaaggaaaca |
42769489 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University