View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0889_low_12 (Length: 356)
Name: NF0889_low_12
Description: NF0889
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0889_low_12 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 75; Significance: 2e-34; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 267 - 345
Target Start/End: Complemental strand, 12225494 - 12225416
Alignment:
Q |
267 |
tttgatccaaatctaaatcattggcttcattttcctctcaacttcctccctttctcttatcctcttccagttgcttcat |
345 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
T |
12225494 |
tttgatccaaatctaaatcattggcttcattttcctctcaacttcctccctttctcttctcctcttccagttgcttcat |
12225416 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 87 - 154
Target Start/End: Complemental strand, 12225674 - 12225607
Alignment:
Q |
87 |
caaatcttctcttccttacctctccaacaaatcatcatctgccgttccctttccaaattcttcaacaa |
154 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
12225674 |
caaatcttctcttccttacctctccaacaaatcatcatctgccgttccctttccaaattcttcaacaa |
12225607 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 279 - 343
Target Start/End: Original strand, 17774568 - 17774632
Alignment:
Q |
279 |
ctaaatcattggcttcattttcctctcaacttcctccctttctcttatcctcttccagttgcttc |
343 |
Q |
|
|
|||||| ||||| | |||||||| |||||||| ||||||||||||| | ||||||||| ||||| |
|
|
T |
17774568 |
ctaaatgattggatccattttcccctcaactttctccctttctcttcccttcttccagtagcttc |
17774632 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1007 times since January 2019
Visitors: 6708