View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0889_low_17 (Length: 269)
Name: NF0889_low_17
Description: NF0889
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0889_low_17 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 1 - 265
Target Start/End: Complemental strand, 48519505 - 48519238
Alignment:
Q |
1 |
attgtatatacgatgatgacatttacattcctgtcctttcgcttatgtctgagtcaataataataacatcaaaatcaacccttcnnnnnnntattcatc- |
99 |
Q |
|
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
T |
48519505 |
attgtatatacgatgatgacatttacattcatgtcctttcgcttatgtctgagtcaataataataacatcaaaatcaacccttcaaaaaaatattcatcc |
48519406 |
T |
 |
Q |
100 |
--catcatcatcgactttttcttcctacaaatttcaattcaataacccattaccctcttatgcacttattcctcaaaaagcttccacctttcgatctacg |
197 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||| |
|
|
T |
48519405 |
atcatcatcatcgactttttcttcctacaaatttcaattcaataacccattaccctcttttgcactaattcctcaaaaagcttccacctttcgatctacg |
48519306 |
T |
 |
Q |
198 |
gtgtcgttttttcagcttgttgaatttagggtatgatcttctaatatgatctctgaggtaaaattggt |
265 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
T |
48519305 |
gtgtcgttttttcagcttgttgaatttagggtatgatcttctaatttgatctctgaggtaaaattggt |
48519238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 623 times since January 2019
Visitors: 6705