View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0889_low_18 (Length: 251)
Name: NF0889_low_18
Description: NF0889
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0889_low_18 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 211; Significance: 1e-116; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 8 - 242
Target Start/End: Complemental strand, 12861038 - 12860804
Alignment:
Q |
8 |
gccaattggctatgtttctgctttctatcactaatcactatgttgagcatactatggttagcaaagggctataggtctctcgttcttttcatgatcatga |
107 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||| |
|
|
T |
12861038 |
gccaattggctatgtttctgctttctatcactaatcactatgttgagcatactacggttagcaaagggctataggtctctcgttcttttcatgttcatga |
12860939 |
T |
 |
Q |
108 |
gtttaaggaagctatgttttctatacaccgaaataaaagctcagttaacgtcaggctggacgtgtgttctcagatgtcaaaatttagtgttgcatcttca |
207 |
Q |
|
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||| |||||||||||||||||| |
|
|
T |
12860938 |
gtttaaggaagttatgttttctatacaccgaaataaaagctcagttaacgtcaggttgggcgtgtgttctcagatgtcaaattttagtgttgcatcttca |
12860839 |
T |
 |
Q |
208 |
tggttgcctctttggttgaggtgttggttctctgc |
242 |
Q |
|
|
||||||||||||||||||||||||||||||||||| |
|
|
T |
12860838 |
tggttgcctctttggttgaggtgttggttctctgc |
12860804 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 146 - 241
Target Start/End: Original strand, 12833135 - 12833230
Alignment:
Q |
146 |
gctcagttaacgtcaggctggacgtgtgttctcagatgtcaaaatttagtgttgcatcttcatggttgcctctttggttgaggtgttggttctctg |
241 |
Q |
|
|
|||| |||||||||||||||| ||||||||||||||||||||| |||||| ||||||||| ||||||||||||||| | ||||| |||||||||| |
|
|
T |
12833135 |
gctcggttaacgtcaggctgggcgtgtgttctcagatgtcaaattttagttttgcatctttgtggttgcctctttggctaaggtgctggttctctg |
12833230 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 46 - 134
Target Start/End: Original strand, 12844507 - 12844595
Alignment:
Q |
46 |
tatgttgagcatactatggttagcaaagggctataggtctctcgttcttttcatgatcatgagtttaaggaagctatgttttctataca |
134 |
Q |
|
|
|||||||||||||||| |||||||| | |||||||||||| | |||| ||||| ||||||||||||||||||||||||||||||||| |
|
|
T |
12844507 |
tatgttgagcatactacggttagcacaaggctataggtctttggttcatttcagattcatgagtttaaggaagctatgttttctataca |
12844595 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
© Oklahoma State University