View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0889_low_23 (Length: 228)
Name: NF0889_low_23
Description: NF0889
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0889_low_23 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 1 - 199
Target Start/End: Complemental strand, 31607562 - 31607364
Alignment:
Q |
1 |
gccagacccataaggaccatagagaatcctcaaaagtttaggtttggcaaacacaccagaaaggattcccccaagaataccagccacagcatgagtgtga |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
31607562 |
gccagacccataaggaccatagagaatcctcaaaagtttaggtttggcaaacacaccagaaaggattcccccaagaataccagccacagcatgagtgtga |
31607463 |
T |
 |
Q |
101 |
aagactcctaatgtatcatctacactttgaaagaatgacgatcttttgtgcaacaccatcatcgtgtaccatggaattgagccggacaaagctcccatc |
199 |
Q |
|
|
||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
T |
31607462 |
aagactcctaatgtatcatctacactttgaaagaatggtgattttttgtgcaacaccatcatcgtgtaccatggaattgaaccggacaaagctcccatc |
31607364 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University