View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0890_high_11 (Length: 230)
Name: NF0890_high_11
Description: NF0890
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0890_high_11 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 7 - 209
Target Start/End: Complemental strand, 27445887 - 27445689
Alignment:
Q |
7 |
ctcacatcctttggtcctgctaccacatcatcacttaatgccactagagcattagatgctacccccacgaagctagaaatttttatgttggtagggacga |
106 |
Q |
|
|
||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
T |
27445887 |
ctcacatcctttggtcccgctaccacatcatcacttaatgccactagtgcattagatgctacccccacgaagctagaaatttttatgttggtagg---ga |
27445791 |
T |
 |
Q |
107 |
tcaactcttctannnnnnnngcctagctcttagggttagaagcggctaattttttctccgttgatataagctttgatgaacaaaggtttaagatgtttta |
206 |
Q |
|
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
27445790 |
tcaactcttcta-tttttttgcctagctcttagggttagaagcggctaattttttctccgttgatataagctttgatgaacaaaggtttaagatgtttta |
27445692 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University