View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0890_high_5 (Length: 334)
Name: NF0890_high_5
Description: NF0890
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0890_high_5 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 125; Significance: 2e-64; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 181 - 305
Target Start/End: Original strand, 45713215 - 45713339
Alignment:
Q |
181 |
gtttacattacaggtaaccacaactatgagaagccaggacttgattggggaacccgtttgaaaatagtgaaaggtgtagcaaggggtttgtcttatctat |
280 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
45713215 |
gtttacattacaggtaaccacaactatgagaagccaggacttgattggggaacccgtttgaaaatagtgaaaggtgtagcaaggggtttgtcttatctat |
45713314 |
T |
 |
Q |
281 |
acagtgcactcccaagtgtgattgt |
305 |
Q |
|
|
||||||||||||||||||||||||| |
|
|
T |
45713315 |
acagtgcactcccaagtgtgattgt |
45713339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 30 - 154
Target Start/End: Complemental strand, 45713339 - 45713215
Alignment:
Q |
30 |
acaatcacacttgggagtgcactgtatagataagacaaaccccttgctacacctttcactattttcaaacgggttccccaatcaagtcctggcttctcat |
129 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
45713339 |
acaatcacacttgggagtgcactgtatagataagacaaaccccttgctacacctttcactattttcaaacgggttccccaatcaagtcctggcttctcat |
45713240 |
T |
 |
Q |
130 |
agttgtggttacctgtaatgtaaac |
154 |
Q |
|
|
||||||||||||||||||||||||| |
|
|
T |
45713239 |
agttgtggttacctgtaatgtaaac |
45713215 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University