View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0890_low_10 (Length: 275)
Name: NF0890_low_10
Description: NF0890
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0890_low_10 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 46 - 237
Target Start/End: Complemental strand, 43224063 - 43223872
Alignment:
| Q |
46 |
catcatcatatagaagcaattgatagggatggatcagaataagttaatgttattgttatccaatgtggttgatgggttgcagtcttctaaaaggacggca |
145 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43224063 |
catcatcatatagaagcaattgatagggatggttcagaataagttaatgttattgttatccaatgtggttgatgggttgcagtcttctaaaaggacggca |
43223964 |
T |
 |
| Q |
146 |
atttaacaaggtataccacatgggcatgttctgttatctccacgtgtttcagaaaacgagaaccctcgatgtcactagtttgactttggtct |
237 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43223963 |
atttaacaaggtataccacatgggcatgttctgttatctccacgtgtttcagaaaacgagaaccctcgatgtcactagtttgactttggtct |
43223872 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University