View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0890_low_14 (Length: 250)
Name: NF0890_low_14
Description: NF0890
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0890_low_14 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 1 - 243
Target Start/End: Original strand, 41891584 - 41891826
Alignment:
Q |
1 |
acacgcttaactgtagagttctgattgggttcggcgcattagtaccgatacaattgcacctatttttgtagctataatttaatatcaacggtcaacagct |
100 |
Q |
|
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
T |
41891584 |
acacgcttaactgtagagttctgattgggttcggcacattagtaccgatacaattgcacctatttttgtagctataatttaatatcaacagtcaacagct |
41891683 |
T |
 |
Q |
101 |
tgatcaactgacatatcgaagcattctttaatttgcatctactaggagttgtgtattatcctctactaaatcttactttcaattgattcaattacaacat |
200 |
Q |
|
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
T |
41891684 |
tgatcaactgacatgtcgaagcattctttaatttgcatctactaggagttgtgtattatcctctactaaatcttactttcaattgattcaattgcaacat |
41891783 |
T |
 |
Q |
201 |
aagttcaaaaactgagttcaccaactgtttatttgcctatgct |
243 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||| |||| |
|
|
T |
41891784 |
aagttcaaaaactgagttcaccaactgtttatttgcctctgct |
41891826 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University